Home Work
first task
The following nucleotide sequence is a cDNA clone from the snake venom library.
AAAACCATCAAATACGTTATGCTGGAATGCAACGAACTGATCCCGCTGTTCTACGAAACCT
GCCCGGCTGGTGAAAACATCTGCTACGAAATGTTCATGGTTGCTACCCCGAAAGTTCCGTGC
GAACGTGGTTGCATCGACGTTTGCCCGGAATCTTCTCTGATCGTTAAATACGTTTGCTGCAA
CACCGACCGTTGCCAGTAATCCAGCGCCTGATCTCTCGAAATAAAAGCCGCATTG
1. Please analyze the cutting patterns of the following restriction enzyme:
EcoRI, Sau3AI, HinfI and MseI.
2. Please find its corresponding polypeptide sequence.
3. Please help me to identify this toxin. Is it a new toxin?
4. Could you find the three-dimensional structure of this toxin or make a model if it is a new protein? Show the structure on your homepage.
main homework